AI & ChatGPT searches , social queriess for THYMINE
Search references for THYMINE. Phrases containing THYMINE
See searches and references containing THYMINE!
Search references for THYMINE. Phrases containing THYMINE
See searches and references containing THYMINE!THYMINE
Chemical compound of DNA
cytosine. Thymine is also known as 5-methyluracil, a pyrimidine nucleobase. In RNA, thymine is replaced by the nucleobase uracil. Thymine was first isolated
Thymine
Type of DNA damage
from a photochemical reaction involving two pyrimidine (P) nucleobases (thymine, cytosine, or uracil) through formation of new covalent bonds. The discovery
Pyrimidine_dimer
Molecule that carries genetic information
nitrogen-containing nucleobases (cytosine [C], guanine [G], adenine [A] or thymine [T]), a sugar called deoxyribose, and a phosphate group. The nucleotides
DNA
Chemical compound of RNA
bonds. In DNA, the uracil nucleobase is replaced by thymine (T). Uracil is a demethylated form of thymine. Uracil is a common and naturally occurring pyrimidine
Uracil
Nitrogen-containing biological compounds that form nucleosides
deoxyribonucleic acid (DNA). Five nucleobases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U)—are called primary or canonical. They function as the
Nucleotide_base
Chemical compound
Thymine glycol (5,6-dihydroxy-5,6-dihydrothymine) is one of the principal DNA lesions that can be induced by oxidation and ionizing radiation. The rate
Thymine_glycol
Biological molecules constituting nucleic acids
DNA are guanine, adenine, cytosine, and thymine (G, A, C, and T); in RNA, uracil (U) is used in place of thymine. Nucleotides also play a central role in
Nucleotide
Aromatic compound (C4H4N2)
three types of nucleobases are pyrimidine derivatives: cytosine (C), thymine (T), and uracil (U). The pyrimidine ring system has wide occurrence in
Pyrimidine
Class of enzymes
and break certain types of pyrimidine dimers that arise when a pair of thymine or cytosine bases on the same strand of DNA become covalently linked. The
Photolyase
Protein-coding gene in the species Homo sapiens
G/T mismatch-specific thymine DNA glycosylase is an enzyme that in humans is encoded by the TDG gene. Several bacterial proteins have strong sequence
Thymine-DNA_glycosylase
Thymine dioxygenase (EC 1.14.11.6) is an enzyme that catalyzes the chemical reaction thymine Fe(IV)=O Fe(II) 5-hydroxymethyluracil The enzyme oxidises
Thymine_dioxygenase
Chemical compound in nucleic acids
nucleotide bases found in DNA and RNA, along with adenine, guanine, and thymine (uracil in RNA). It is a pyrimidine derivative, with a heterocyclic aromatic
Cytosine
Chemical compound of DNA and RNA
the nucleic acids DNA and RNA, the others being adenine, cytosine, and thymine (uracil in RNA). In DNA, guanine is paired with cytosine. The guanine nucleoside
Guanine
Chemical compound
5,6-Dihydro-5(α-thyminyl)thymine is a DNA pyrimidine dimer photoproduct produced when DNA in bacterial spores is exposed to ultraviolet light. In bacteria
5,6-Dihydro-5(α-thyminyl)thymine
5,6-Dihydro-5(α-thyminyl)thymine
Chemical compound in DNA and RNA
crystalline subtance. The shape of adenine is complementary and pairs to either thymine in DNA or uracil in RNA. In cells, adenine is rare as an independent molecule
Adenine
Form of electromagnetic radiation
ultraviolet radiation. UVB causes thymine base pairs next to each other in genetic sequences to bond together into thymine dimers, a disruption in the strand
Ultraviolet
Over- or under-abundance of guanine and cytosine in a particular region of DNA or RNA
genome) there is an equal frequency of the four DNA bases (adenine, guanine, thymine, and cytosine) on both single strands of a DNA molecule. However, in most
GC_skew
Removal of an amino group from a molecule
replication fork, can be corrected by the enzyme thymine-DNA glycosylase, which removes the thymine base in a G/T mismatch. This leaves an abasic site
Deamination
G-bands. Darkly colored R bands are guanine-cytosine rich, and adenine-thymine rich regions are more readily denatured by heat. The technique is useful
R‑banding
Two rules about the percentage of A, C, G, and T in DNA strands
of cytosine and the amount of adenine should be equal to the amount of thymine. Further, a 1:1 stoichiometric ratio of purine and pyrimidine bases (i
Chargaff's_rules
Lock-and-key pairing between two structures
between nucleobases: adenine, thymine (uracil in RNA), guanine and cytosine. Adenine and guanine are purines, while thymine, cytosine and uracil are pyrimidines
Complementarity (molecular biology)
Complementarity_(molecular_biology)
Fluorescent stain
6-diamidino-2-phenylindole, is a fluorescent stain that binds strongly to adenine–thymine-rich regions in DNA. It is used extensively in fluorescence microscopy
DAPI
Biological process
the pyrimidine ring where the DNA base thymine's methyl group is located; the same position distinguishes thymine from the analogous RNA base uracil, which
DNA_methylation
DNA sequence required in bacterial promoters for transcription
Pribnow-Schaller box) is a sequence of TATAAT of six nucleotides (thymine, adenine, thymine, etc.) that is an essential part of a promoter site on DNA for
Pribnow_box
RNA that is read by the ribosome to produce a protein
where the coding DNA strand contains thymine. Structurally, uracil–adenine (U–A) base pairs closely resemble thymine–adenine (T–A) base pairs, which ensures
Messenger_RNA
Chemical compound
body] The prefix deoxy- is often left out since there are no precursors of thymine nucleotides involved in RNA synthesis. Before the boom in thymidine use
Thymidine
1997 film by Andrew Niccol
based on the letters G, A, T, and C, which stand for guanine, adenine, thymine, and cytosine, the four nucleobases of DNA. It was a 1997 nominee for the
Gattaca
traditional subcloning. The technique relies on the ability of adenine (A) and thymine (T) (complementary basepairs) on different DNA fragments to hybridize and
TA_cloning
Chemical compound
the pyrophosphate group, the pentose sugar ribose, and the nucleobase thymine. Unlike the other deoxyribonucleotides, thymidine diphosphate does not
Thymidine_diphosphate
Class of enzymes
Uracil/thymine dehydrogenase (EC 1.17.99.4, uracil oxidase, uracil-thymine oxidase, uracil dehydrogenase) is an enzyme with systematic name uracil:acceptor
Uracil/thymine_dehydrogenase
Succession of nucleotides in a nucleic acid
RNA, except with U (uracil) replacing T (thymine). Apart from adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), DNA and RNA also contain
Nucleic_acid_sequence
Benzo-homologated DNA analogue
ring and one of the four natural bases: adenine, guanine, cytosine, and thymine. This size expansion produces an 8 letter alphabet which has a larger information
XDNA
Type of RNA
strands found in cells. It is similar to DNA but with the replacement of thymine by uracil and the adding of one oxygen atom. Despite the structural similarities
Double-stranded_RNA
Burning of the skin by the sun's radiation
DNA is damaged by UVB light. This damage is mainly the formation of a thymine dimer. The body recognizes such UVB damage on mRNA, which then triggers
Sunburn
Study of chemical processes of living organisms
binds with thymine and uracil, thymine binds only with adenine, and cytosine and guanine can bind only with one another. Adenine, thymine, and uracil
Biochemistry
Process of determining the nucleic acid sequence
technology that is used to determine the order of the four bases: adenine, thymine, cytosine, and guanine. The advent of rapid DNA sequencing methods has
DNA_sequencing
Class of large biomolecules essential to all known life
bases found in RNA and DNA are: adenine, cytosine, guanine, thymine, and uracil. Thymine occurs only in DNA[dubious – discuss] and uracil only in RNA
Nucleic_acid
dUMP, thereby ensuring that the organism's DNA contains the nucleobase thymine instead of uracil. DUT, the human version of this gene dnaA dnaB dnaC dnaE
DnaS
Topics referred to by the same term
English personal pronoun thou (archaic) Thy (district), Jutland, Denmark Thymine, one of the four nucleobases in the nucleic acid of DNA Turkish Airlines
Thy
One of the five major nucleosides in nucleic acids
lacks a hydroxyl group at the 2' position. 5-Methyluridine contains a thymine base joined to a ribose pentose sugar. It is a white solid. m5U is one
5-Methyluridine
Enzyme
sugar unit: thymidine Pi Pi 2-deoxy-α-D-ribose 1-phosphate + thymine Thymidine phosphorylase is involved in purine metabolism, pyrimidine metabolism
Thymidine_phosphorylase
sequence of ATGAGTCAT, where A corresponds to adenine, T corresponds to thymine, G corresponds to guanine, and C corresponds to cytosine. AP-1 nucleotide
AP-1_binding_site
Two nucleobases bound by hydrogen bonds
(or "Watson–Crick–Franklin") base pairs (guanine–cytosine and adenine–thymine/uracil) allow the DNA helix to maintain a regular helical structure that
Base_pair
Medical condition
dihydropyrimidine dehydrogenase, an enzyme involved in the metabolism of uracil and thymine. Individuals with this condition may develop life-threatening toxicity
Dihydropyrimidine dehydrogenase deficiency
Dihydropyrimidine_dehydrogenase_deficiency
Property of nucleic acid strands with respect to their translatability into protein
translated or translatable into a sequence of amino acids (provided that any thymine bases in the DNA sequence are replaced with uracil bases in the RNA sequence)
Sense_(molecular_biology)
American biochemist (1869–1940)
nucleic acid, DNA from RNA, and found that DNA contained adenine, guanine, thymine, cytosine, deoxyribose, and a phosphate group. He was born into a Litvak
Phoebus_Levene
DNA repair process
and hydrolysis of 5-methylcytosine to thymine, producing G:U and G:T base pairs. If the improper uracils or thymines in these base pairs are not removed
Base_excision_repair
amplification by polymerase chain reaction, the uracils are converted into thymines. Methylated cytosines are then recognized as cytosines. Their locations
Whole genome bisulfite sequencing
Whole_genome_bisulfite_sequencing
Assembly of proteins inside biological cells
adenine and thymine (G, C, A and T). RNA is also composed of four bases: guanine, cytosine, adenine and uracil. In RNA molecules, the DNA base thymine is replaced
Protein_biosynthesis
Replication of DNA
units are made up of a nitrogenous base (cytosine, guanine, adenine or thymine), pentose sugar (deoxyribose) and phosphate group. Each unit is joined
DNA_synthesis
Epigenetic phenomenon
5hmC to generate 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC). Thymine-DNA glycosylase (TDG) recognizes the intermediate bases 5fC and 5caC and
Reprogramming
Percentage of guanine and cytosine in DNA or RNA molecules
C bases out of an implied four total bases, also including adenine and thymine in DNA and adenine and uracil in RNA. GC-content may be given for a certain
GC-content
Biological process
reduce its fidelity. Base analog such as 5-bromouracil may substitute for thymine in replication. Metals such as cadmium, chromium, and nickel can increase
Mutagenesis
Microbial protein found in Escherichia coli str. K-12 substr. MG1655
group attached to DNA bases like guanine (O6-alkyl guanine) or thymine (O4-alkyl thymine) and to the oxygen of the phosphodiester backbone of the DNA.
Ada_(protein)
Region of often-methylated DNA with a cytosine followed by a guanine
regulation that is called epigenetics. Methylated cytosines often mutate to thymines. In humans, about 70% of promoters located near the transcription start
CpG_site
Protein-coding gene in the species Homo sapiens
activity, acting on DNA mismatched DNA binding guanine/thymine mispair binding single thymine insertion binding Cellular component condensed chromosome
MSH4
Chemical compound
the metabolism of thymine. The enzyme dihydrouracil dehydrogenase (NAD+) converts thymine to dihydrothymine in the reaction: thymine + NADH H+ H+
Dihydrothymine
Type of enzyme inhibition by forming an irreversible complex with the substrate
as a suicide inhibitor of thymidylate synthase during the synthesis of thymine from uridine. This reaction is crucial for the proliferation of cells,
Suicide_inhibition
Method for analyzing DNA methylation using enzymes
uracil (U) through enzymatic conversion before sequencing and read as thymine (T). This enzymatic conversion of cytosine to uracil is achieved through
Enzymatic_methyl-seq
Chemical compound
uracil that acts as an antimetabolite or base analog, substituting for thymine in DNA, and can induce DNA mutation in the same way as 2-aminopurine. It
5-Bromouracil
Heterocyclic aromatic organic compound
pyrimidines, thymine and cytosine, respectively. This is called complementary base pairing. In RNA, the complement of adenine is uracil instead of thymine. Other
Purine
Chemical compound which is a modified DNA base
nucleic acid was found to be unusual, in that it contained in addition to thymine, guanine and cytosine, a methylated nucleotide. In 1925, Johnson and Coghill
5-Methylcytosine
Cohen in Escherichia coli when thymine-requiring mutants of the bacteria lost viability when grown in a medium lacking thymine but containing other essential
Thymineless_death
Protein-coding gene in Homo sapiens
functions as a molecular switch. In normal DNA, adenine (A) bonds with thymine (T) and cytosine (C) bonds with guanine (G). Sometimes there will be a
MSH6
External facility on the ISS dedicated to astrobiology experiments
the identification of the spore photoproduct 5,6-dihydro-5(α-thyminyl)thymine. The data disclose the limits of lithopanspermia for spores located in
EXPOSE
Radio message sent into space in 1974
Deoxyribose (C5H7O) Adenine (C5H4N5) Thymine (C5H5N2O2) Deoxyribose (C5H7O) Phosphate (PO4) Phosphate (PO4) Deoxyribose (C5H7O) Cytosine (C4H4N3O) Guanine
Arecibo_message
Chemical compound
mutagen. It acts by adding alkyl groups to the O6 of guanine and O4 of thymine, which can lead to transition mutations between GC and AT. These changes
Methylnitronitrosoguanidine
Life arising from non-living matter
pyrimidine nucleobases including guanine, adenine, cytosine, uracil, and thymine, as well as sugars, have been found in meteorites. These could have provided
Abiogenesis
Laboratory technique for DNA methylation profiling
conversion of methylated cytosines, 5mC and 5hmC, to uracil which is read as a thymine after sequencing. Due to direct conversion of methylated bases, TAPS is
TET-assisted pyridine borane sequencing
TET-assisted_pyridine_borane_sequencing
Class of enzymes
adenine dinucleotide phosphate (NADPH) as its cofactor. It can also act on thymine to give dihydrothymine. In humans the enzyme is encoded by the DPYD gene
Dihydropyrimidine dehydrogenase (NADP+)
Dihydropyrimidine_dehydrogenase_(NADP+)
Chemical compound
which a methyl group is attached to the oxygen atom. It base-pairs to thymine rather than cytosine, causing a G:C to A:T transition in DNA. 6-O-Methylguanine
6-O-Methylguanine
guanine to adenine at base position 1896 (G1896A), and from cytosine to thymine at position 1858 (C1858T) in the precore region of the viral genome. The
Hepatitis B virus precore mutant
Hepatitis_B_virus_precore_mutant
Product of thymine metabolism
β-aminoisobutyric acid or BAIBA) is a product formed by the catabolism of thymine and valine. During exercise, the increase of PGC-1α protein triggers the
3-Aminoisobutyric_acid
Protein-coding gene in the species Homo sapiens
synthesis, it will add adenine opposite to thymine in the syn conformation and can add both cytosine and thymine in the anti conformation across guanine
DNA_polymerase_iota
Chemical compound
and the second is the non-intentional incorporation of pyrimidine where thymine belongs in the DNA, resulting in dUMP. UMP synthase deficiency is a metabolic
Deoxyuridine
Protein-coding gene in the species Homo sapiens
This enzyme dephosphorylates the 5'- and 2'(3')-phosphates of uracil and thymine deoxyribonucleotides. The gene is located within the Smith–Magenis syndrome
NT5M
Very large molecule
DNA), and a nucleotide base (either adenine, guanine, thymine, uracil, or cytosine, where thymine occurs only in DNA and uracil only in RNA).[citation
Macromolecule
Nuclear genetic code in some flagellates
TCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine
Blastocrithidia_nuclear_code
Free radical toxicity
gamma-radiation-induced guanine-thymine and thymine-guanine intrastrand cross-links in mammalian cells and translesion synthesis past the guanine-thymine lesion by human
Oxidative_stress
Enzymes which cleave a nucleotide chain
Exposure of bacteriophage (phage) T4 to ultraviolet irradiation induces thymine dimers in the phage DNA. The phage T4 denV gene encodes endonuclease V
Endonuclease
Science of synthetic life forms
standard A, C and G nucleotides but has the synthetic thymine analogue 5-chlorouracil instead of thymine (T) in the corresponding positions of the sequence
Xenobiology
Class of chemical compounds
bases: adenine, guanine, cytosine and thymine. RNA also contains adenine, guanine, and cytosine, but replaces thymine with uracil. Thus, DNA synthesis requires
Nucleoside_triphosphate
Process where substrates are converted into more complex products in living organisms
mechanism. In contrast to uracil, thymine bases are found mostly in DNA, not RNA. Cells do not normally contain thymine bases that are linked to ribose
Biosynthesis
Chemical compound
5-Ethynyl-2′-deoxyuridine (EdU) is a thymidine analogue which is incorporated into the DNA of dividing cells. EdU is used to assay DNA synthesis in cell
5-Ethynyl-2'-deoxyuridine
given position (for example, 10% Adenine, 75% Guanine, 5% Cytosine & 10% Thymine). As an example, with the degenerate code R = A + G, 50% of the time that
DNA_spiking
DNA or RNA sequence that matches its complement when read backwards
directions, and the nucleotides always pair in the same way (adenine (A) with thymine (T) in DNA or uracil (U) in RNA; cytosine (C) with guanine (G)), a (single-stranded)
Palindromic_sequence
Sequence of DNA that determines traits in an organism
adenine base pairing to thymine and guanine to cytosine. The specificity of base pairing occurs because adenine and thymine align to form two hydrogen
Gene
Disorder in which muscles fail to relax
expansion. The microsatellite expansion responsible for DM1 is of cytosine-thymine-guanine (CTG) triplet repeats, termed trinucleotide repeat expansion and
Myotonic_dystrophy
Process of copying a segment of DNA into RNA
complement that includes the nucleotide uracil (U) in all instances where thymine (T) would have occurred in a DNA complement. Only one of the two DNA strands
Transcription_(biology)
Chemical compound
Methylmalonic acid semialdehyde is an intermediate in the metabolism of thymine and valine. It is a substrate of the enzyme methylmalonate-semialdehyde
Methylmalonic acid semialdehyde
Methylmalonic_acid_semialdehyde
Chemical compound
and acts by transferring the ethyl group of ENU to nucleobases (usually thymine) in nucleic acids. Its main targets are the spermatogonial stem cells,
ENU
Most common type of skin cancer
be BCC.[needs update] Overexposure to the sun leads to the formation of thymine dimers, a form of DNA damage. While DNA repair removes most UV-induced
Basal-cell_carcinoma
Heritable characteristics affecting learning
has also recently been indicated, since GADD45 physically interacts with thymine-DNA glycosylase (TDG) and GADD45 may promote the activity of TDG in its
Epigenetics in learning and memory
Epigenetics_in_learning_and_memory
Basepairing interactions within a single nucleic acid polymer or between two polymers
adenine (A) forms a base pair with thymine (T) and guanine (G) forms one with cytosine (C) in DNA. In RNA, thymine is replaced by uracil (U). Alternate
Nucleic acid secondary structure
Nucleic_acid_secondary_structure
Damage to the structure of a biological molecule
lesions are general across DNA and RNA, some are specific to one, such as thymine dimers being found exclusively in DNA. Several cellular repair mechanisms
Molecular_lesion
Stain used for diagnosis of malaria
attaches itself to regions of DNA where there are high amounts of adenine-thymine bonding. Giemsa stain is used in Giemsa banding, commonly called G-banding
Giemsa_stain
Scientific hypotheses on the origin and evolution of DNA
nucleobases for DNA and RNA (including the pyrimidines uracil, cytosine, and thymine) are present in carbonaceous meteorites. Complex organic compounds essential
Origin_of_DNA
Chemical compound
research. It most commonly pairs with thymine as an adenine-analogue. It uses a different ketone oxygen on thymine for H-bonding and forms a stronger bond
2-Aminopurine
German biochemist and pioneer in the study of genetics
compounds that are present in nucleic acid: adenine, cytosine, guanine, thymine, and uracil. These compounds were later shown to be nucleobases, and are
Albrecht_Kossel
Chemical compound
collectively called Hoechst stains. Bisbenzimide tends to bind to adenine–thymine-rich regions of DNA and can decrease its density. Bisbenzimide mixed with
Bisbenzimide
THYMINE
THYMINE
THYMINE
THYMINE
Male
German
 Pet form of German Luitpold, POLDI means "people-bold." Compare with another form of Poldi.
Girl/Female
Hindu
Angle, Of noble kind
Surname or Lastname
English (mainly Devon and Cornwall)
English (mainly Devon and Cornwall) : variant spelling of Mitchell.
Girl/Female
English
Consecrated.
Girl/Female
Australian, Danish, Dutch, Finnish, Hebrew
Dove; God is Gracious
Boy/Male
Teutonic
Defender.
Girl/Female
Tamil
Devoshri | தேவோஷà¯à®°à¯€Â
The diamond of Kohinoor
Girl/Female
Hindu
Biblical
abstruse; concealed; consumed
Girl/Female
Tamil
Beautiful girl, Loveliness
THYMINE
THYMINE
THYMINE
THYMINE
THYMINE