AI & ChatGPT searches , social queriess for SP6
Search references for SP6. Phrases containing SP6
See searches and references containing SP6!
Search references for SP6. Phrases containing SP6
See searches and references containing SP6!SP6
Topics referred to by the same term
SP6 may refer to : SP6 RNA polymerase, a RNA polymerase related to the T7 RNA polymerase one of the three versions of the 9x39 mm rifle cartridge a model
SP6
CPU socket for AMD CPUs
Socket SP6 (LGA 4844) is a zero insertion force land grid array CPU socket designed by AMD supporting its Zen 4c-based Siena Epyc server processors that
Socket_SP6
Wheelchair sport classification
F6, also SP6, is a wheelchair sport classification that corresponds to the neurological level L2 - L5. Historically, this class has been known as Lower
F6_(classification)
CPU socket for AMD HEDT/workstation CPUs
PRO CPU and a WRX90 motherboard. Ryzen Socket sWRX8 Socket sTRX4 Socket SP6 Bonshor, Gavin (October 19, 2023). "AMD Unveils Ryzen Threadripper 7000 Family:
Socket_sTR5
AMD brand of server microprocessors
8004 series of CPUs, codenamed Siena. Siena utilizes a new socket, called SP6, which has a smaller footprint and pin count than the SP5 socket of its contemporary
Epyc
Maker of steam powered toys and models
similar to the SP6 model in the product range but features twin cylinders. The SP7 utilizes the same boiler and burner unit as the SP6, which can be equipped
Mamod
2020 AMD 7-nanometer processor microarchitecture
new sockets, which are AM5 for the desktop "Ryzen" chips alongside SP5 and SP6 for the EPYC server platform and sTRX8. According to AMD, Zen 3 has a 19%
Zen_3
Para-swimming classification
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was little
S5_(classification)
Motorsport season
4000cc and a turbocharger. SP10 – For FIA- and SRO-homologated GT4 cars. SP6 – Purpose-built racecars with an engine capacity between 3000 and 3499cc
2019_VLN_Series
Season of television series
The cast of the television series MythBusters perform experiments to verify or debunk urban legends, old wives' tales, and the like. This is a list of
MythBusters_(2005_season)
Web browser for Windows released in 1999
support Windows 3.1x, Windows NT 3.51, Windows 95 and Windows NT 4.0 SP3—SP6. The actual release of Internet Explorer 5 happened in three stages. First
Internet_Explorer_5
Protein-coding gene in the species Homo sapiens
encoded by the KLF14 gene. The corresponding Klf14 mouse gene is known as Sp6. KLF14 is a member of the Krüppel-like factor family of transcription factors
KLF14
American guitar manufacturer
Fano Standard line of guitars was launched in 2016 and includes the JM6, SP6, TC6 and RB6. Dennis Fano, founder of the company, repaired guitars at Matt
Fano_Guitars
Town in Hampshire, England
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire and
Fordingbridge
US Army Sgt 1st Class, Medal of Honor, Silver Star, Purple Heart (1928–1984)
gallantry and intrepidity at the risk of life above and beyond the call of duty. SP6 Joel demonstrated indomitable courage, determination, and professional skill
Lawrence_Joel
Motor vehicle automatic and manual transmissions
Petrol & Diesel, Roewe 550, Mazda6, Mazda CX-7, Mazda CX-9, Land Rover LR2 SP6 — 6-speed Porsche 997 SA6 - 6-speed Lexus LFA April 1997– BC6 — 6-speed August
List_of_Aisin_transmissions
Scottish politician
30 March 2021. Retrieved 10 May 2026. Stephen, Phyllis (2 April 2021). "#SP6 - the Alba Party fields four candidates on the Lothian list - we talk to
Irshad_Ahmed_(politician)
Designated marksman rifle
1 in) Width 83 mm (3.3 in) Height 280 mm (11.0 in) Cartridge 9×39mm: SP5, SP6, PAB-9, SPP, BP Action Gas-operated, rotating bolt Rate of fire 700 rounds/min
VSK-94
supported Netscape Step-Up for compatibility (though this support in the NT 4.0 SP6 and IE 5.01 version had a bug where changing MAC algorithms during Step-Up
Server-Gated_Cryptography
Assault rifle
The AMB-17 is chambered for the 9×39mm subsonic cartridge (SP5 FMJ and SP6 armour-piercing), and uses the VSS Vintorez-pattern detachable box magazines
Kalashnikov_Concern_AMB-17
Para-swimming classification
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was little
S6_(classification)
Japanese immunologist and Nobel laureate (born 1942)
cDNA encoding the murine IgG1 induction factor by a novel strategy using SP6 promoter". Nature. 319 (6055): 640–646. Bibcode:1986Natur.319..640N. doi:10
Tasuku_Honjo
Class of enzymes
TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins
T7_RNA_polymerase
Military rank
abbreviation was changed from "SP4" to "SPC" upon the elimination of the SP5 and SP6 ranks, the SIDPERS database was authorized to continue using SP4 until the
Specialist_(rank)
Para-swimming classification
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was little
S8_(classification)
Integrated development environment by Microsoft
can be run on the Windows 9x platform, as well as Windows NT 4.0 before SP6, but after SP2. Each version of each language in part also settled to v6
Visual_Studio
CPU socket for AMD CPUs
Naples Rome Milan Predecessor Socket C32 Socket G34 Successor Socket SP5 Socket SP6 Memory support ECC DDR4 This article is part of the CPU socket series
Socket_SP3
Extension for ArcGIS Desktop
0 More ArcToolbox tools for use with ModelBuilder, rectangular 24hr or seasonal data clocks, point cluster renderer, temporal slider 9.2 SP6 – 9.3.1
CrimeAnalyst
1502 treaty between England and Scotland
Office, E39/58, E39/59, E39/81; and Edinburgh National Archives of Scotland, SP6/31. Accounts of the Treasurer of Scotland, vol. 2 (Edinburgh, 1900), pp.
Treaty_of_Perpetual_Peace
Para-swimming classification
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was little
S7_(classification)
Para-swimming classification
significant difference in performance times between women in 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the 100m breaststroke. It found there was little
S4_(classification)
1996 Microsoft operating system version
(SP4) October 25, 1998 Service Pack 5 (SP5) May 4, 1999 Service Pack 6 (SP6) October 27, 1999 Service Pack 6a (SP6a) November 22, 1999 Post SP6a Security
Windows_NT_4.0
2022 AMD 5-nanometer processor microarchitecture
Desktop Socket AM5 HEDT/Workstation Socket sTR5 Server Socket SP5 Socket SP6 Cache L1 cache 64 KB (per core): 32 KB instructions 32 KB data L2 cache 1 MB
Zen_4
Database manager part of the Microsoft 365 package
Professional, Premium and Developer Access 2002 10.0 May 31, 2001 Windows NT 4.0 SP6, Windows 98, Windows 2000, Windows Me Office XP Professional and Developer
Microsoft_Access
American knife company
version of the original Ka-Bar Mark 3 Navy diving/survival knife Spec Plus SP6 Fighter and SP13 Tango Spec Plus SP25 USN-2 Navy knife Spec Plus SP26 USN-3
Ontario_Knife_Company
User-definable variable associated with each running process in many operating systems
Application Data directory of the logged-in user. Does not work on Windows NT 4.0 SP6 UK. %LOCALAPPDATA% This variable is the local data files of Applications
Environment_variable
Village and parish in Hampshire, England
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire and
Damerham
CPU socket for AMD CPUs
Socket AM5, contemporary desktop socket from AMD in use since 2022 Socket SP6, server socket for low power and edge systems supporting the Siena family
Socket_SP5
Endurance motor race in Germany
Riegel Mike Stursberg Wolfgang Kohler Georg Berlandy Porsche GT3 Cup S 141 21 SP6 169 Dörr Motorsport GmbH Stefan Aust Dierk Möller-Sonntag Peter Posavac Hanspeter
2010_24_Hours_of_Nürburgring
ENSG00000204335 C2H2 ZF Known motif – In vivo/Misc source [868] ACCVCGCCKCCSS SP6 ENSG00000189120 C2H2 ZF Inferred motif from similar protein – High-throughput
List of human transcription factors
List_of_human_transcription_factors
Village and parish in Hampshire, England
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Dialling code 01725 Police Hampshire and Isle of Wight Fire Hampshire and
Rockbourne
Technique in molecular biology
resolution. Limited processivity: Bacteriophage RNA polymerases such as T7, SP6, and T3 can dissociate from the DNA template before reaching the end of the
Run-off_transcription
Planned class of German cruisers
Kiel to build these vessels. In December 1941, 3 engines for SP4, SP5 and SP6 were ordered but not the ships. SP1 was the only ship for which the keel
Spähkreuzer
hormone regulating properties and regulation of the nervous system include SP6, LR3, and RN4. Qigong is another practice that consists of meditation, breathing-exercises
Premenstrual_water_retention
Malaysian government-owned company
Line Station Name and Code 3 Ampang Line 4 Sri Petaling Line AG6 SP6 Bandaraya-UOB AG9 SP9 BBCC-Hang Tuah 5 Kelana Jaya Line KJ11 Kampung Baru-Co-opbank
Prasarana_Malaysia
Instruction for x86 microprocessors
= 0 (which is so by default). As the name suggests, Windows NT 4.0 until SP6 did not boot properly unless this bit was set, but later versions of Windows
CPUID
Circuit board-microprocessor connection
4677 2022 Intel Sapphire Rapids intel Emerald Rapids Server LGA 4677 Socket SP6 2023 AMD Epyc Siena Server LGA 4844 Socket sTR5 2023 AMD Ryzen Threadripper
CPU_socket
matured. HarmonyOS 5.0.0.110 SP6 public beta also released. On April 17, 2025, final update, HarmonyOS NEXT 5.0.0.155 SP6 public beta rolled out starting
HarmonyOS_version_history
Version of Microsoft Office suite
promotional campaign for Office XP. Office XP is compatible with Windows NT 4.0 SP6 through Windows Vista and Windows Server 2008. It is the last version of
Microsoft_Office_XP
Village and parish in Hampshire, England
Sovereign state United Kingdom Post town FORDINGBRIDGE Postcode district SP6 Police Hampshire and Isle of Wight Fire Hampshire and Isle of Wight Ambulance
Woodgreen
International border
Gorizia (Italy) and Nova Gorica, which lie next to each other. A34 / H4 SP6 / 617 SR58 / A3 / E61 + E70 SP10 / 205 SS14 / E61 / 7 SP13 / 627 SS15 / H5
Italy–Slovenia_border
Enterprise software
As such, BPS is missing out on some functions that full BES did get from SP6 onwards, such as rich content email, free/busy search, and remote search
BlackBerry Unified Endpoint Manager
BlackBerry_Unified_Endpoint_Manager
Wheelchair sport classification
(SP5, SP6) in the discus. It found there was little significant difference in performance in time between men in 2 (SP4), 3 (SP4, SP5) and 4 (SP5, SP6) in
F4_(classification)
Office suite software
1 Mac OS X v10.4-Mac OS X v10.6: v4.0 Windows 95: v1.1.5 Windows NT 4.0 SP6: v1.1.x Windows 98 and Windows ME: v2.4.3 Windows 2000 Service Pack 2 or
OpenOffice.org
Belgian astronomer (1936–2022)
QH8 16 August 1990 list (35081) 1990 QT8 16 August 1990 list (35083) 1990 SP6 22 September 1990 list (35084) 1990 SP9 22 September 1990 list 35087 von
Eric_Walter_Elst
Endurance motor race in Germany
Schratz Johannes Siegler Arno Klasen Jörg Viebahn Porsche 996 GT3-RS 138 7 SP6 69 Rudi Adams Rainer Dörr Marc Hennerici Gregor Vogler BMW M3 CSL 137 8 SP7
2006_24_Hours_of_Nürburgring
1999 edition of the FIFA Women's World Cup
Hope, Cautiously, That a New Pro League Will Form". The New York Times. p. SP6. Archived from the original on September 6, 2012. Retrieved May 13, 2019
1999_FIFA_Women's_World_Cup
Village and parish in Hampshire, England
Sovereign state United Kingdom Post town Fordingbridge Postcode district SP6 Dialling code 01425 Police Hampshire and Isle of Wight Fire Hampshire and
Sandleheath
American reality television series
2013 (2013-02-10) 114 1.80 SP5 "Halloween Too" March 13, 2014 (2014-03-13) 313-60 1.92 SP6 "Never Boo-fore Seen" March 20, 2014 (2014-03-20) 314-60 1.86 SP7 "New Years
Here_Comes_Honey_Boo_Boo
Retrieved 14 November 2012. "Larry Jamerson, SP6". The Virtual Wall. Retrieved 14 November 2012. "Frankie Johnson, SP6". The Virtual Wall. Retrieved 14 November
List_of_United_States_servicemembers_and_civilians_missing_in_action_during_the_Vietnam_War_(1968–69)
Wheelchair sport classification
performance in distance between women in 2 (SP4), 3 (SP4, SP5), 4 (SP5, SP6), 5 (SP6, SP7) and 6 (SP7) in the discus. It found there was little significant
F7_(classification)
BlackObsidian (BlackRock Holdings) - Amber Hawkins
iPlanet Web Server 4.1 SP6. iPlanet Web Server 4.1 SP3. iPlanet Web Server 4.1 SP2. iPlanet Web Server 4.1. iPlanet Web Server 4.0 SP6. iPlanet Web Server
Oracle_iPlanet_Web_Server
Scientific research project
Neuroinformatics Platform: Gathering, organising and making available brain data SP6 Brain Simulation Platform: Developing data-driven reconstructions of brain
Human_Brain_Project
American football player (born 1977)
20, 2005). "Katz confident Goss will return". The Hamilton Spectator. pp. SP6. Retrieved November 25, 2025. Parker, Jim (March 22, 2006). "CFL free agents"
Mat_Petz
Species of true bug
"Unraveling the Enigma of an Atlantic Prairie". Northeastern Naturalist. 19 (sp6). Humboldt Field Research Institute: 13–42. doi:10.1656/045.019.s603. ISSN 1092-6194
Philaenarcys_bilineata
German racing driver (born 1964)
Masters HWA Team 10 2 0 2 7 71 1st 24 Hours of Nürburgring Raeder Motorsport SP6 Mitsubishi Lancer Evo VIII 1 0 ? ? 0 N/A 6th 2007 Deutsche Tourenwagen Masters
Bernd Schneider (racing driver)
Bernd_Schneider_(racing_driver)
Malaysian passenger railway lines
AG4/SP4 PWTC KA04 Putra 12 AG5/SP5 Sultan Ismail MR9 Medan Tuanku 8 AG6/SP6 Bandaraya KA03 Bank Negara 12 KJ13 AG7/SP7 Masjid Jamek 5 AG8/SP8 Plaza Rakyat
Ampang_and_Sri_Petaling_lines
Type of surface-mount packaging for integrated circuits
Socket sWRX8 (LGA 4094) Socket AM5 (LGA 1718) Socket SP5 (LGA 6096) Socket SP6 (LGA 4844) Socket sTR5 (LGA 4844) LGA 771 (Socket J) – Note that Socket 771
Land_grid_array
Protein-coding gene in the species Homo sapiens
M, Szpirer J, Szpirer C (Nov 2000). "Identification of KLF13 and KLF14 (SP6), novel members of the SP/XKLF transcription factor family". Genomics. 70
KLF11
September 16, 2003 Kitt Peak Spacewatch MAS 980 m MPC · JPL 115082 2003 SP6 — September 17, 2003 Desert Eagle W. K. Y. Yeung · 1.5 km MPC · JPL 115083
List of minor planets: 115001–116000
List_of_minor_planets:_115001–116000
Endurance motor race in Germany
Sabine Schmitz Klaus Abbelen Edgar Viersen Kenneth Heyer Porsche 997 145 4 SP6 64 ORMS Racing Marko Hartung Stefan Neuberger Franz Engstler BMW Z4 M Coupe
2008_24_Hours_of_Nürburgring
China-born American acupuncturist (1926–2009)
Lee describes a combination of points that have wide application: ST36, SP6, LI4, LI11, and LU7. She also popularized the Master Tung Ching Chang's Magic
Miriam_Lee
Linux distribution
Enterprise Server 15 SP5". "Release Notes | SUSE Linux Enterprise Server 15 SP6". "Release Notes | SUSE Linux Enterprise Server 15 SP7". "Release Notes |
SUSE_Linux_Enterprise
Canadian writer (1923–2007)
(May 14, 2004). "James Barber Finds a New Groove". The National Post. p. SP6. The Urban Peasant stopped production in 2000... "TV chef James Barber of
James_Barber_(author)
Earth's most severe extinction event
"An Analysis of the History of Marine Animal Diversity". Paleobiology. 33 (sp6): 1–55. Bibcode:2007Pbio...33R...1S. doi:10.1666/06020.1. McKinney, M. L
Permian–Triassic extinction event
Permian–Triassic_extinction_event
Speech recognition software package
Standard, Preferred, Professional, Legal, Medical Windows 98, Me, NT 4.0 SP6+, 2000. 6.0 November 15, 2001 Essentials, Standard, Preferred, Professional
Dragon_NaturallySpeaking
DNA construct
some BACs also have lacZ at the cloning site for blue/white selection. T7 & Sp6 phage promoters for transcription of inserted genes. BACs are now being utilized
Bacterial artificial chromosome
Bacterial_artificial_chromosome
Integrated development environment product
0 97 1100 5 Visual Studio 6.0 SP5 6.0 1200 12008804 6 Visual Studio 6.0 SP6 6.0 1200 12008804 6 Visual Studio .NET 2002 [7.0] 7.0 2002 1300 13009466
Microsoft_Visual_C++
La Silla H. Debehogne · 5.2 km (3.2 mi) MPC · JPL 4685 Karetnikov 1978 SP6 Karetnikov September 27, 1978 Nauchnij N. S. Chernykh THM 19 km (12 mi) MPC ·
List of minor planets: 4001–5000
List_of_minor_planets:_4001–5000
夢のカレー大会だゾ（2013年）〈再〉) "Handmade Jiaozi (2013) <again>" (Japanese: 手作りギョーザだゾ（2013年）〈再〉) Good–SP6 "Going to Father Farm (2014) <again>" (Japanese: ファザー牧場に行くゾ（2014年）〈再〉) June 6
List of Crayon Shin-chan episodes (2012–2021)
List_of_Crayon_Shin-chan_episodes_(2012–2021)
Family of zinc finger transcription factors
are Sp factors: Sp1, Sp2, Sp3, Sp4, Sp5, Sp6, Sp7, Sp8, and Sp9. Note that although KLF14 was an alias for Sp6 (Q3SY56), it now refers to a protein (Q8TD94)
Kruppel-like_factors
Mobile device management software
Released October 2015 (as SAP Afaria SP7) Version 7.0 SP6: Released September 2015 (as SAP Afaria SP6) Version 7.0 SP5: Released August 2014 (as SAP Afaria
SAP_Afaria
Command for configurations from the command-line
lot of information about a remote user. This has changed in Windows NT 4.0 SP6 already. In Windows 2000 "null session connections" could have been enabled
Net_(command)
H. Kosai, K. Furukawa EUN 7.2 km (4.5 mi) MPC · JPL 9154 Kolʹtsovo 1982 SP6 Kolʹtsovo September 16, 1982 Nauchnij L. I. Chernykh EOS 9.9 km (6.2 mi)
List of minor planets: 9001–10000
List_of_minor_planets:_9001–10000
Sports season
Cayrolle ST12 Roberto Colciago Roberto Colciago AGS Motorsport Sandro Sardelli SP6 Duncan Huisman Peter Kox Duncan Huisman Carly Motorsport Tom Ferrier 7 ST13
2001 European Super Touring Championship
2001_European_Super_Touring_Championship
Specialist insignia of 1959 E9 E8 E7 E6 E5 E4 Specialist 9 Specialist 8 Specialist 7 Specialist 6 Specialist 5 Specialist 4 SP9 SP8 SP7 SP6 SP5 SP4
United States Army enlisted rank insignia
United_States_Army_enlisted_rank_insignia
49th season of the German endurance series
Purpose-built racecars with an engine capacity between 2501 and 3000 cc. SP6 Purpose-built racecars with an engine capacity between 3001 and 3500 cc.
2026 Nürburgring Langstrecken-Serie
2026_Nürburgring_Langstrecken-Serie
Web browser
December 8, 2018. Hicks, Jon (April 27, 2006). "A quick guide to Omniweb 5.5 sp6". Hicksdesign. Retrieved December 8, 2018. Sharps, Linda (September 7, 2006)
OmniWeb
German racing driver (born 1992)
Blancpain GT Series Endurance Cup 1 0 0 0 0 11 20th 24 Hours of Nürburgring - SP6 SetupWizzard Racing 1 0 1 1 1 N/A 2nd 2020 IMSA SportsCar Championship -
Mario_Farnbacher
2013. "Leonard Schoeppner, LT". Virtualwall.org. Retrieved 21 April 2013. "SP6 Edward Robinson". Virtualwall.org. Retrieved 21 April 2013. "MAJ Gary Bernard
List_of_United_States_servicemembers_and_civilians_missing_in_action_during_the_Vietnam_War_(1970–71)
Competition classification for disabled athletes in sports
Wheelchair basketball: 2-point player Wheelchair fencing: 2, 3/Category B, A F6/SP6 Lower 4, Upper 5 L2 - L5 F56 S5, SB5, S7, S8 Wheelchair basketball: 3-point
Disability sport classification
Disability_sport_classification
48th season of the German endurance series
Purpose-built racecars with an engine capacity between 2501 and 3000 cc. SP6 Purpose-built racecars with an engine capacity between 3001 and 3500 cc.
2025 Nürburgring Langstrecken-Serie
2025_Nürburgring_Langstrecken-Serie
List of most notable tournaments in Super Smash Bros. Ultimate
Nicholas (October 21, 2019). "Umebura SP6 results". EventHubs. Retrieved June 27, 2020. "ウメブラSP6 /UmeburaSP6 | シングルストーナメント / Singles". smash.gg. October
List of major Super Smash Bros. Ultimate tournaments
List_of_major_Super_Smash_Bros._Ultimate_tournaments
46th season of the German endurance series
Purpose-built racecars with an engine capacity between 2500 and 2999 cc. SP6 Purpose-built racecars with an engine capacity between 3000 and 3499 cc.
2023 Nürburgring Langstrecken-Serie
2023_Nürburgring_Langstrecken-Serie
5th episode of the 34th season of The Simpsons
Congratulations to: Blake H., Henderson NV | Jay C., Paducah KY https://t.co/MQfHO8fSp6" (Tweet). Retrieved January 16, 2023 – via Twitter. Aslanian, Emily (October
Not_It
Belgian racing driver
Artur Deutgen Philipp Peter Dieter Quester BMW M3 E46 A6 9 DNF DNF 2008 RJN Motorsport Alex Buncombe Harald Müller Nicki Thiim Nissan 350Z SP6 12 DNF DNF
Vincent_Vosse
Species of owl
Data in Suburban New York and Connecticut". Northeastern Naturalist. 19 (sp6): 143–158. doi:10.1656/045.019.s611. ISSN 1092-6194. S2CID 56388364. Artuso
Eastern_screech_owl
Genetic disorder resulting in abnormal enamel
published as C4orf26), SLC24A4, LAMB3, ITGB6,, FAM20A, FAM20C, COL17A1, LTBP3, SP6 and GPR68. Amelogenesis imperfecta is identified in families with disease
Amelogenesis_imperfecta
Okayama Astrophysical Observatory is situated. JPL · 9153 9154 Kolʹtsovo 1982 SP6 Kolʹtsovo, a suburb of Novosibirsk, is the site of the State Scientific Institute
Meanings of minor-planet names: 9001–10000
Meanings_of_minor-planet_names:_9001–10000
Endurance motor race in Germany
Alzen Uwe Alzen Christian Menzel Christian Mamerow Porsche Cayman H 108 ? 5 SP6 50 Motorsport Arena Oschersleben Claudia Hürtgen Hans-Joachim Stuck Johannes
2007_24_Hours_of_Nürburgring
SP6
SP6
SP6
SP6
Girl/Female
Latin
Ardent. Eager. Industrious.
Boy/Male
Arabic, Muslim
Precious; Respectable; Dear
Boy/Male
German
Wealthy
Boy/Male
Hindu, Indian
Smooth; En-snarled by Beauty; Attracted; Lord Shiva
Surname or Lastname
English
English : variant spelling of Rayner 1.
Surname or Lastname
English
English : habitational name from any of several places, for example in the county of Middlesex (now part of Greater London) and Northamptonshire (Cranford St. Andrew and Cranford St. John), named with Old English cran ‘crane’ + ford ‘ford’.
Girl/Female
American, British, English, Greek
Abbreviation of Teresa which is a Popular Saint's Name of Uncertain; Harvester; Abbreviation of Teresa
Girl/Female
Muslim/Islamic
Entertaining female companion
Girl/Female
Muslim/Islamic
Good
Girl/Female
Bengali, Indian
Type of Song which is Sung in Monsoon Time
SP6
SP6
SP6
SP6
SP6