AI & ChatGPT searches , social queriess for M45
Search references for M45. Phrases containing M45
See searches and references containing M45!
Search references for M45. Phrases containing M45
See searches and references containing M45!M45
Topics referred to by the same term
M45 or variants may refer to: Carl Gustaf m/45, a 9×19mm Swedish submachine gun M45, a variant of the M26 Pershing heavy/medium tank of the United States
M45
American machine gun mount
The M45 quad mount is a towed anti-aircraft gun consisting of four .50 caliber M2 Browning machine guns mounted in pairs on either side of an armored
M45_quad_mount
Executive car by Infiniti (1989 - 2019)
a hiatus, the M nameplate was used for Infiniti's short-lived mid-luxury M45 sedan, a rebadged version of the Japanese-spec Nissan Gloria and Infiniti's
Infiniti_M
Submarine-launched ballistic missile
The M45 SLBM was a French Navy submarine-launched ballistic missile (In French terminology, the MSBS - Mer-Sol-Ballistique-Stratégique (Sea-ground-Strategic
M45_(missile)
The M45 Project (or M45) is the name of a cluster announced in November 2007 by Yahoo!. According to Yahoo!, it has approximately 4,000 processors, three
Yahoo_M45
Motorway in England
The M45 is a dual two lane motorway in Northamptonshire and Warwickshire, England and is 7.9 miles (12.7 km) long. It runs between junction 17 of the
M45_motorway
Star cluster in the constellation of Taurus
ˈplaɪ-/ PLEE-ə-deez, PLAY-, PLY-), also known as Seven Sisters and Messier 45 (M45), is an asterism of an open star cluster containing young B-type stars in
Pleiades
French class of ballistic missile submarines
first three boats were originally armed with the French-produced and armed M45 intermediate-range missile, and the fourth vessel, Le Terrible, tested and
Triomphant-class_submarine
Submachine gun
The Kulsprutepistol m/45 (Kpist m/45), also known as the Carl Gustaf M/45 and the Swedish K SMG, is a 9×19mm Swedish submachine gun (SMG) designed by Gunnar
Carl_Gustaf_m/45
Human Y-chromosome DNA haplogroup
Haplogroup P1, also known as P-M45 and K2b2a, is a Y-chromosome DNA haplogroup in human genetics. Defined by the SNPs M45 and PF5962, P1 is a primary branch
Haplogroup_P1_(Y-DNA)
Submarine-launched ballistic missile
ArianeGroup, and deployed with the French Navy. Designed to replace the M45 SLBM (in French terminology the MSBS – Mer-Sol-Balistique-Stratégique "Sea-ground-Strategic
M51_(missile)
Masters M45 marathon world record progression is the progression of world record improvements of the marathon M45 division of Masters athletics. Records
Masters M45 marathon world record progression
Masters_M45_marathon_world_record_progression
SNECMA M45, also called the SNECMA Mars, was a turbojet engine designed and produced by SNECMA in France during the late 1950s and early 1960s. The M45 was
SNECMA_M45
Semi-automatic pistol
completely phased out. Modernized derivative variants of the M1911, such as the M45 MEU(SOC) and the M45A1 CQBP, as are still in use by some units of the US
M1911_pistol
Human Y-chromosome DNA haplogroup
has an unknown distribution, and P1c* (P-M45*) is commonly found among Siberians and Central Asians. P-M45 is the parent node of Haplogroup Q (Q-M242)
Haplogroup_P_(Y-DNA)
Metropolitan route in eThekwini, South Africa
The M45 also named Queen Nandi Drive is a short metropolitan route in the eThekwini Metropolitan Municipality, South Africa. The road connects Briardene
M45_(Durban)
US military truck
featured a full-length M45 chassis (178 inch wheelbase, identical to the M35 cargo), while the M275 featured a shortened M45 chassis (166 in wheelbase)
M35 series 2½-ton 6×6 cargo truck
M35_series_2½-ton_6×6_cargo_truck
Metropolitan route in Greater Johannesburg, South Africa
The M45 is a long metropolitan route in Greater Johannesburg, South Africa. It connects Kempton Park with Dunnottar (north of Nigel) via Benoni, Brakpan
M45_(Johannesburg)
International athletics championship event
M35 to M45: 110 m. M50–M65: 100 m. M70 and over: 80 m. Categories M35 to M55: 400 m. M60–M65: 300 m. M70 and over: 200 m. Categories M35 to M45: 7.26 kg
2024 World Masters Athletics Championships
2024_World_Masters_Athletics_Championships
Human Y-chromosome DNA haplogroup
this has not been verified. P1 (M45/PF5962), also known as K2b2a, is hundreds of times more common than P* (K2b2; PxM45), as it includes haplogroups Q
Haplogroup_K2b_(Y-DNA)
Spanish arms manufacturer
Model M40: .40 S&W single-action pistol. Star Model M43: 9mm Star Firestar M45: .45ACP single-action pistol. Its weight is 2.5 lb with full magazine of
Star_Bonifacio_Echeverria
This is the progression of world record improvements of the 800 metres M45 division of Masters athletics. Key Incomplete information Pending Masters
Masters M45 800 metres world record progression
Masters_M45_800_metres_world_record_progression
Submachine gun
The Madsen M1945 or M45 is a submachine gun introduced in 1945. It was produced by the Danish company Dansk Industri Syndikat of Copenhagen, Denmark.
Madsen_M1945
International athletics championship event
M35 to M45: 110 m, M50–M65: 100 m, M70 and over: 80 m. Categories M35 to M55: 400 m, M60–M65: 300 m, M70 and over: 200 m. Categories M35 to M45: 7.26 kg
2025 European Masters Athletics Championships
2025_European_Masters_Athletics_Championships
record progression Masters M40 marathon world record progression Masters M45 marathon world record progression Masters M50 marathon world record progression
Marathon world record progression
Marathon_world_record_progression
Masters M45 javelin throw world record progression is the progression of world record improvements of the javelin throw M45 division of Masters athletics
Masters M45 javelin throw world record progression
Masters_M45_javelin_throw_world_record_progression
Division Weight thrown M35 16 lb/7.260 kg M40 16 lb/7.260 kg M45 16 lb/7.260 kg M50 6 kg M55 6 kg M60 5 kg M65 5 kg M70 4 kg M75 4 kg M80 3 kg M85 3 kg
Masters shot put world record progression
Masters_shot_put_world_record_progression
Japanese luxury car brand, a subsidiary of Nissan
sedan by Consumer Reports.[citation needed] The M45 model featured the same engine as the Q45, and the M45 became the flagship model after the Q45 was discontinued
Infiniti
Masters M45 discus world record progression is the progression of world record improvements of the discus M45 division of Masters athletics. Records must
Masters M45 discus world record progression
Masters_M45_discus_world_record_progression
Reciprocating internal combustion engine
Lifan 520 Mini Hatch and Convertible (until 2008). The 1.6 SC uses an Eaton M45 Roots type supercharger with intercooler. The compression ratio is reduced
Tritec_engine
.50-caliber heavy machine gun
later variants, twin and quadruple M2HB Brownings were used, such as the M45 Quadmount (aka "meat chopper") used on the U.S. M16 half-track carrier. Twin
M2_Browning
Tractor manufacturers of France
brand Someca: Someca M45 Someca M45 cane Someca M50 "Pesados Argentinos: Someca M45". 11 April 2015. "Pesados Argentinos: Someca M45 cañero". 11 April 2015
Someca
2020 science fiction film by Liam O'Donnell
Production companies Hydraulx Entertainment Liam O'Donnell Films XYZ Films m45 Productions Gifflar Films Limited Gifflar (Patriot) Films Limited UAB Cobaltas
Skylines_(film)
Type of autoimmune arthritis
Classification D ICD-11: FA20, FA92.0Z (spine) ICD-10: M05-M06, M45 (spine) ICD-10-CM: M05-M06, M45 (spine) ICD-9-CM: 714 OMIM: 180300 MeSH: D001172 DiseasesDB:
Rheumatoid_arthritis
Semi-automatic pistol
unit (special operations capable) (MEU(SOC))") officially designated the M45 MEUSOC, is a magazine-fed, recoil-operated, single-action, semiautomatic
MEU(SOC)_pistol
Pos Athlete Age Country Result Karnell Vickers M49 United States 11.09 Takeshi Fukuzato M45 Japan 11.10 Reggie Pendland M47 United States 11.12
2016 World Masters Athletics Championships Men
2016_World_Masters_Athletics_Championships_Men
Japanese automobile manufacturing company
the transliteration of the Japanese すばる, meaning the Pleiades star cluster M45, or the "Seven Sisters" (one of whom tradition says is invisible — hence
Subaru
Motor vehicle
Lagonda company from 1936 until 1937. It was an evolution of the Lagonda M45. The name of the car comes from the L.G. Motors brand and the displacement
Lagonda_LG45
Submarine-launched ballistic missile
JL-2 – (China) JL-3 – (China) UGM-133 Trident II – (United States) M45 – (France) M45 – (France) K-6 – (India) Pukguksong-5 – (North Korea) "SS-N-20". Archived
R-39_(missile)
This is the progression of world record improvements of the 100 metres M45 division of Masters athletics. Key Incomplete information Wind aided Pending
Masters M45 100 metres world record progression
Masters_M45_100_metres_world_record_progression
Gas mask used by the US military
the M40 field protective mask and M42, the MCU-2/P series masks, and the M45 of the Land Warrior Program. The M50 series mask entered service in December
M50 Joint Service General Purpose Mask
M50_Joint_Service_General_Purpose_Mask
Nuclear submarine in the French Navy
behind schedule. The boat had, in May 1999, successfully test launched an M45 submarine-launched ballistic missile. List of submarines of France "French
French_submarine_Le_Téméraire
International athletics championship event
M35 to M45: 110 m, M50–M65: 100 m, M70 and over: 80 m. Categories M35 to M55: 400 m, M60–M65: 300 m, M70 and over: 200 m. Categories M35 to M45: 7.26 kg
2023 European Masters Athletics Championships
2023_European_Masters_Athletics_Championships
Nissan Skyline M-series Sedan - Q70 1989 2013 Nissan Fuga Q45 Sedan - M35 M45 1989 2006 Nissan Cima Nissan President QX4 SUV - QX56 FX JX 1996 2002 Nissan
List_of_Infiniti_vehicles
American film series
Albertson & Banner Gwin Vertical Entertainment, Hydraulx Entertainment, m45 Productions, XYZ Films, Beijing Creastar Picture International Ltd., Arlberg
Skyline_(film_series)
Weapon
equipped with four .50 caliber (12.7 mm) M2 Browning machine guns in an M45 Quadmount. 2700 were produced by White Motor Corporation from May 1943 to
M16 Multiple Gun Motor Carriage
M16_Multiple_Gun_Motor_Carriage
Human Y chromosome DNA grouping common among Native Americans
PMC 384887. PMID 11731934. The SNPs used in the paper are P-M45, R1a1-M17, Q1a2-M3, and other xP-M45 SNPs. And the author mentions that, among ethnic groups
Haplogroup_Q-M242
2 from 2015; M51.3 projected from 2025 onwards) S2 IRBM S3 IRBM M4 SLBM M45 SLBM Jericho III is a road mobile ICBM which entered service in 2008, a three-stage
List of intercontinental ballistic missiles
List_of_intercontinental_ballistic_missiles
Self-propelled gravity-assisted guided weapon flying from an independent underwater craft
French M45 SLBM and M51 SLBM in cross-section of a submarine.
Submarine-launched ballistic missile
Submarine-launched_ballistic_missile
1997 novel by Arthur Golden
States Media type Print (hardback & paperback) Pages 448 pp ISBN 0-375-40011-7 OCLC 37689141 Dewey Decimal 813/.54 21 LC Class PS3557.O35926 M45 1997
Memoirs_of_a_Geisha
Infantry mortar
training shell until it was replaced by the M68 training practice shell. M45 heavy HE: 15.10 lb (6.85 kg); HE filling 4.48 lb (2.03 kg); range max 1275 yd
M1_mortar
Group of similar haplotypes
(M119) Haplogroup O1b (P31, M268) Haplogroup O2 (M122) Haplogroup P-M45 (M45) (M45 occurred ~35,000 bp) Haplogroup Q-M242 (M242) (Occurred ~15,000–20,000
Haplogroup
Major road in England
M42, then bypasses Coventry and Rugby, where it briefly merges with the M45 until it continues to Daventry. It then heads to Northampton and Wellingborough
A45_road
International athletics championship event
Event Pos Athlete Country Results M45 100 Meters Marion McCoy USA 11.70 Stan Whitley USA 11.75 Robert Mitchell USA 11.90 M45 200 Meters Robert Mitchell USA
1995 World Masters Athletics Championships
1995_World_Masters_Athletics_Championships
Masters M45 hammer throw world record progression is the progression of world record improvements of the hammer throw M45 division of Masters athletics
Masters M45 hammer throw world record progression
Masters_M45_hammer_throw_world_record_progression
Submarine-launched ballistic missile
missiles, with six 150 kilotonne warheads. They were replaced by the improved M45 SLBM missile which was in service aboard the Triomphant-class submarine.
M4_(missile)
Type of arthritis of the spine
Classification D ICD-11: FA92.0Z ICD-10: M08.1, M45 ICD-9-CM: 720 OMIM: 106300 MeSH: D013167 DiseasesDB: 728 SNOMED CT: 9631008 External resources MedlinePlus:
Ankylosing_spondylitis
Held at İzmir in Turkey
Event/Age M35 M40 M45 M50 M55 M60 M65 M70 M75 M80 M85 M90 100 metres X X X X X X X X X X X X 200 metres X X X X X X X X X X X X 400 metres X X X X X X
2014 European Masters Athletics Championships
2014_European_Masters_Athletics_Championships
Irish long-distance runner (1939–2016)
Masters Athletics World Championships, when Ron Robertson was challenged by M45 record holder Antonio Villanueva, with both surpassing McNamara's record
James_McNamara_(athlete)
Double star system in the constellation Taurus
constellation of Taurus and a member of the Pleiades open star cluster (M45). It consists of a binary pair designated 19 Tauri A together with a single-star
Taygeta
Submarine-launched ballistic missile
was withdrawn from service by 1991. It was largely succeeded by the M4 and M45 missiles. The M20 was the third member of the MSBS (Mer-Sol-Balistique-Stratégique
M20_(missile)
English footballer (born 2002)
"Rogers has 'a big quality' in waiting". Daily Echo. 17 November 2021. pp. M45. Retrieved 8 August 2025. "Bournemouth beaten by late Luton goal". BBC Sport
Morgan_Rogers
Human settlement in England
England Sovereign state United Kingdom Post town MANCHESTER Postcode district M45 Dialling code 0161 Police Greater Manchester Fire Greater Manchester Ambulance
Stand,_Greater_Manchester
Archived from the original on 2016-05-12. Retrieved 2016-05-16. "Wieslaw Pietka (M45) suspended for doping offence". EMACS 2012 Results (PDF). EVAA. 2012.
M45 at the 2012 European Masters Athletics Championships
M45_at_the_2012_European_Masters_Athletics_Championships
French thermonuclear bomb warhead
service since 2016, replacing the TN 75 warhead, originally designed for the M45, and which also equipped the M51, pending the development and service entry
Tête_nucléaire_océanique
The twenty-third World Masters Athletics Championships were held in Málaga, Spain, from September 4–September 16, 2018. This was the second even year of
2018 World Masters Athletics Championships Men
2018_World_Masters_Athletics_Championships_Men
Rear-wheel-drive small family car
and 66. To add to the car's appeal and boost its sales, Volvo adapted the M45 manual transmission from the 200 series to fit in place of the CVT, and sold
Volvo_300_Series
Straight-4 cylinder engine from 1993
ML EVO. This is a 2.0L Kompressor engine utilizing a supercharger (Eaton M45, black pulley) similar to the 2.3L M111.974 engine, but with a lower power
Mercedes-Benz_M111_engine
US military vehicle
half-track – M3 based multiple gun motor carriage equipped with the Maxson M45 Quadmount (specifically the M45D) with four M2HB machine guns (5,000 rounds)
M3_half-track
Defunct German mobile phone manufacturer
Siemens M35 Siemens M35i: one of the most popular Siemens phones Siemens M45 Siemens M50 Siemens M55 Scorpions Siemens M56: GSM 850 / GSM 1900 version
Siemens_Mobile
Movie studio and residence in Los Angeles
Lookout Mountain photographer on camera mount. A re-purposed M45 Quadmount
Lookout Mountain Air Force Station
Lookout_Mountain_Air_Force_Station
Frigates in the Royal Netherlands Navy
air-surveillance radar, the DA-02 medium-range air/surface search radar and the M45 combined radar and optical fire control system for the 4.5 in (110 mm) guns
Van_Speijk-class_frigate
Electra (17 Tauri) 400 ± 10 Taurus B6 IIIe 3.70 Part of Pleiades Cluster (M45). Psi² Aquarii 400 ± 20 Aquarius B5 Vn 4.403 Beta¹ Scorpii (Acrab/HR 5985)
List of star systems within 400–450 light-years
List_of_star_systems_within_400–450_light-years
Astronomical objects catalogued by Charles Messier
inclusions followed. The first edition of 1774 covered 45 objects (M1 to M45). The total list published by Messier in 1781 contained 103 objects, but
Messier_object
This is the progression of world record improvements of the 200 metres M45 division of Masters athletics. Key Incomplete information Wind aided Pending
Masters M45 200 metres world record progression
Masters_M45_200_metres_world_record_progression
Metropolitan route in Greater Johannesburg, South Africa
junction with the M45 road (Snake Road). The M44 joins the M45 and they are one road northwards up to the next junction, where the M45 becomes its own road
M44_(Johannesburg)
American compact crossover SUV
Manual FWD MG3 2002–2003 5-Speed Aisin AF33 Automatic FWD/AWD M09 (FWD 6), M45 (AWD 6) 2002–2005 VTi VT25-E CVT Automatic FWD/AWD M75 (FWD 4), M16 (AWD
Saturn_Vue
British luxury car marque owned by Aston Martin
(160 km/h) 4.5-litre M45 with a Meadows-supplied six-cylinder, 4,467 cc, engine. A true sporting version, the M45R Rapide, with a tuned M45 engine and a shorter
Lagonda
US WWII "deuce and a half" cargo truck
CCKW-353-B2 gun truck with M45 Quadmount on M20 trailer in bed, loading ramps attached to side
GMC_CCKW_2½-ton_6×6_truck
Royal Netherlands Navy vessel
21 mph) Complement 284 Sensors & processing systems Radar LW-02, DA-01, ZW-01, M45, Sonar Type PAE 1N, Type CWE 10 Armament 4 × Bofors 120 mm guns (2 × 2) 6
HNLMS_Friesland_(D812)
Star in the Taurus constellation
constellation of Taurus and a member of the Pleiades open star cluster (M45) of stars. 16 Tauri is a blue-white B-type subgiant with an apparent magnitude
Celaeno_(star)
This is the progression of world record improvements of the long jump M45 division of Masters athletics. Key Incomplete information Pending Masters
Masters M45 long jump world record progression
Masters_M45_long_jump_world_record_progression
Mobile phone model by Siemens
CX65 CXF65 CXT65 CT65 CX70 CXT70 CXV70 CXI70 C72 C75 CF75 CX75 M M30 M35i M45 ME45 MX45 M50 MT50 M55 MC60 M65 M75 ME75 S S25 S35i S40 S42 S45 S45i S55
Siemens_SL10
Former motorway in Hertfordshire, England
of Wolverhampton. The M10 opened on 2 November 1959 along with the M1 and M45, and was designed and constructed by Tarmac Construction as part of the St
M10_motorway_(Great_Britain)
Mobile phone by Siemens
CX65 CXF65 CXT65 CT65 CX70 CXT70 CXV70 CXI70 C72 C75 CF75 CX75 M M30 M35i M45 ME45 MX45 M50 MT50 M55 MC60 M65 M75 ME75 S S25 S35i S40 S42 S45 S45i S55
Siemens_SL45
American medium/heavy battle tank (1944–1951)
from Korea during 1951 and replaced with M4A3 Shermans and M46 Pattons. The M45 howitzer tank variant was only used by the assault gun platoon of the 6th
M26_Pershing
1966 Van Speijk-class frigate
range air/surface surveillance radar carried on the ship's foremast. M44 and M45 fire control radars were provided for the Seacat missiles and the ship's
HNLMS_Evertsen_(F815)
Binary star system in the constellation Taurus
constellation of Taurus. It is a member of the Pleiades, an open star cluster (M45). It is 444 light-years (136 parsecs) away, and is 3.92 degrees north of
Atlas_(star)
US Cold War medium tank
Troy D. (11 March 2002). The M26 Pershing and variants: T26/M26, M26A1, M45, M46/M46A1 (1st ed.). Schiffer Publishing. ISBN 978-0764315442. LCCN 2001096784
M46_Patton
Rotary cannon
Rock Island Arsenal in 1964. They were accepted as a replacement for the M45 Quadmount in 1965, and first production M167s were delivered to the U.S.
M167_VADS
Place in KwaZulu-Natal, South Africa
around Newlands East is the N2 highway, M45 Queen Nandi Drive, M5 Dumisani Makhaye Drive and M21 Inanda Road. The M45 Queen Nandi Drive is the main thoroughfare
Newlands_East
1992 novel by John Updike
States Media type Print (hardcover) and (audio-CD) Pages 369 pp ISBN 0-679-41681-1 OCLC 26055447 Dewey Decimal 813/.54 20 LC Class PS3571.P4 M45 1992b
Memories of the Ford Administration
Memories_of_the_Ford_Administration
2006 mobile phone model
CX65 CXF65 CXT65 CT65 CX70 CXT70 CXV70 CXI70 C72 C75 CF75 CX75 M M30 M35i M45 ME45 MX45 M50 MT50 M55 MC60 M65 M75 ME75 S S25 S35i S40 S42 S45 S45i S55
BenQ-Siemens_EL71
aggcactggtcagaatgaag aatggaaaatacagctcccc M3 M4 M8 M9 M15 M17 M20 M33 M35 M38 M40 M42 M45 M52 M55 M57 M60 M64.1 M75 M89 M91 M94 M95 M96 M105 M122 M124 M130 M131 M132
List of Y-DNA single-nucleotide polymorphisms
List_of_Y-DNA_single-nucleotide_polymorphisms
equipment), he dominated the competition and became World Champion in Sprint M45 (12:49). This victory was the result of specific preparation supervised by
Jérôme_Baudson
Worcestershire, Warwickshire, West Midlands, Leicestershire 1976 154,532 40.0 64.4 M45 A spur from the M1 south of Rugby. Warwickshire, Northamptonshire 1959 19
List of motorways in the United Kingdom
List_of_motorways_in_the_United_Kingdom
Proprietary rear-wheel steering system
is also found on models from the Infiniti division, such as the Q45, J30, M45/M35 and G35/G37. Unlike many other four-wheel steering systems, HICAS and
HICAS
French rocket test site
S2, MSBS M20, SSBS S3, Nike Orion, MSBS M4, Hades, Black Brant 9CM1, MSBS M45 and MSBS M51. Map all coordinates using OpenStreetMap Download coordinates
DGA_Essais_de_missiles
Mobile phone range created by Siemens Mobile
CX65 CXF65 CXT65 CT65 CX70 CXT70 CXV70 CXI70 C72 C75 CF75 CX75 M M30 M35i M45 ME45 MX45 M50 MT50 M55 MC60 M65 M75 ME75 S S25 S35i S40 S42 S45 S45i S55
Xelibri
Community school in Whitefield, Greater Manchester, England
Philips High School Location Higher Lane Whitefield , Greater Manchester , M45 7PH England 53°32′47″N 2°17′58″W / 53.546285°N 2.299504°W / 53.546285;
Philips_High_School
M45
M45
M45
M45
Girl/Female
Hindu
Girl/Female
Hindu
Lord Vishnu, Prowess
Girl/Female
Scottish American
Christian.
Boy/Male
Sikh
All-pervading light
Boy/Male
Assamese, Gujarati, Indian
A Star
Girl/Female
Hindu, Indian
Happiness
Surname or Lastname
English and Scottish
English and Scottish : of uncertain origin. According to Reaney this is an occupational name for a shepherd, from Middle English wether ‘wether’, ‘ram’ + herd ‘herdsman’. His evidence for this interpretation of the final syllable is alternation in the late 15th century between Weydurherd and Wedirhed. Black speculates that the name may be a topographic name from a hill in Berwickshire.
Boy/Male
Muslim
Surname or Lastname
English
English : patronymic from the personal name Steven. It is also found in this spelling as a Dutch and North German name, and as an Americanized form of some like-sounding Jewish name, as well as cognate names in other European languages such as Stefan and Steffen and their derivatives.
Girl/Female
Gujarati, Hindu, Indian, Kannada, Malayalam, Marathi, Sindhi, Telugu
Faith; Firmness; Accusatory
M45
M45
M45
M45
M45